Online Inquiry
Map2k5 cDNA ORF Clone, Mouse, C-His tag
SPD-10266
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 5 with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | MEK5 |
Gene Abbr. | Map2k5 |
Gene ID | 23938 |
Full Name | mitogen-activated protein kinase kinase 5 |
Alias | AI324775, AI428457, MEK5, Mapkk5, Prkmk5 |
Introduction | MEK5 is a dual specific kinase that specifically activates ERK5 involved in the regulation of diverse cellular processes, including cell growth, survival, and differentiation. The MEK5-ERK5 pathway is activated in numerous cancer types and plays a role in tumor growth and metastasis. Pharmacological targeting of the MEK5-ERK5 pathway has been investigated as a strategy for cancer treatment. MEK5 is activated by a variety of stimuli, including growth factors, cytokines, and oxidative stress. Activation of MEK5 is triggered by upstream kinases MEKK2 and MEKK3, leading to phosphorylation of MEK5 at Ser311 and Thr315, which subsequently leads to MEK5 dependent phosphorylation of EKR5 at Thr218 and Tyr220. Phosphorylation of ERK5 leads to nuclear translocation and regulation of several oncogenic transcription factors, including MEF2C, c-Fos, c-Myc, and Sap1. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 5 with C terminal His tag. |
NCBI Ref Seq | NM_011840.2 |
RefSeq ORF Size | 1347 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.