Online Inquiry
Map2k4 cDNA ORF Clone, Mouse, untagged
SPD-13555
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 4. |
Target Information | |
---|---|
Species | Mouse |
Target Name | SEK1/MKK4 |
Gene Abbr. | Map2k4 |
Gene ID | 26398 |
Full Name | mitogen-activated protein kinase kinase 4 |
Alias | JNKK, JNKK1, MAPKK 4, MEK4, MKK4 |
Introduction | SAPK/Erk kinase (SEK1), also known as MKK4 or Jun kinase kinase (JNKK), activates the MAP kinase homologues SAPK and JNK in response to various cellular stresses and inflammatory cytokines. Activation of SEK1 occurs through MEKK phosphorylation of serine and threonine residues at positions 257 and 261, respectively. Like MEK, SEK is a dual-specificity protein kinase that phosphorylates SAPK/JNK at a conserved T*PY* site in its activation loop. Phosphorylation by Akt at Ser80 inhibits SEK1 and suppresses stress-activated signal transduction. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 4. |
NCBI Ref Seq | NM_009157.4 |
RefSeq ORF Size | 1194 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.