MAP2K3 Knockout Cell Line - CD BioSciences

service-banner

MAP2K3 Knockout Cell Line

MAP2K3 Knockout Cell Line

SPL-01967

Size Price
1 Unit Online Inquiry
Description
14bp deletion
Target Information
Target Name MKK3
Gene Abbr. MAP2K3
Gene ID 5606
Full Name mitogen-activated protein kinase kinase 3
Alias MAPKK3, MEK3, MKK3, PRKMK3, SAPKK-2
Species Human
Genomic Locus chr17:21300617
Transcript NM_002756
WT Expression Level 38.82 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is activated by mitogenic and environmental stress, and participates in the MAP kinase-mediated signaling cascade. It phosphorylates and thus activates MAPK14/p38-MAPK. This kinase can be activated by insulin, and is necessary for the expression of glucose transporter. Expression of RAS oncogene is found to result in the accumulation of the active form of this kinase, which thus leads to the constitutive activation of MAPK14, and confers oncogenic transformation of primary cells. The inhibition of this kinase is involved in the pathogenesis of Yersina pseudotuberculosis. Multiple alternatively spliced transcript variants that encode distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of MAP2K3.
Description 14bp deletion
Parental Cell Line C631
Guide RNA Sequence AAGGTGCGGCACGCCCAGAG
PCR Primer Forward: ACTGACTCTCTTTTCCATCCTTCAA
Reverse: CGGTACTGATCACTGAGAGGGATA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.