Online Inquiry
MAP2K3 Knockout Cell Line
SPL-01966
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 139bp insertion |
| Target Information | |
|---|---|
| Target Name | MKK3 |
| Gene Abbr. | MAP2K3 |
| Gene ID | 5606 |
| Full Name | mitogen-activated protein kinase kinase 3 |
| Alias | MAPKK3, MEK3, MKK3, PRKMK3, SAPKK-2 |
| Species | Human |
| Genomic Locus | chr17:21300617 |
| Transcript | NM_002756 |
| WT Expression Level | 38.82 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is activated by mitogenic and environmental stress, and participates in the MAP kinase-mediated signaling cascade. It phosphorylates and thus activates MAPK14/p38-MAPK. This kinase can be activated by insulin, and is necessary for the expression of glucose transporter. Expression of RAS oncogene is found to result in the accumulation of the active form of this kinase, which thus leads to the constitutive activation of MAPK14, and confers oncogenic transformation of primary cells. The inhibition of this kinase is involved in the pathogenesis of Yersina pseudotuberculosis. Multiple alternatively spliced transcript variants that encode distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 139bp insertion in a coding exon of MAP2K3. |
| Description | 139bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAGGTGCGGCACGCCCAGAG |
| PCR Primer |
Forward: ACTGACTCTCTTTTCCATCCTTCAA Reverse: CGGTACTGATCACTGAGAGGGATA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.