Map2k3 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Map2k3 cDNA ORF Clone, Mouse, N-FLAG tag

Map2k3 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-10364

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 3 with N terminal Flag tag.
Target Information
Species Mouse
Target Name MKK3
Gene Abbr. Map2k3
Gene ID 26397
Full Name mitogen-activated protein kinase kinase 3
Alias AW212142, MAPKK 3, MEK3, MKK3, MKK3b
Introduction MKK3 and MKK6 are two closely related dual-specificity protein kinases that activate p38 MAP kinase. MKK3 and MKK6 both phosphorylate and activate p38 MAP kinase at its activation site, Thr-Gly-Tyr, but do not phosphorylate or activate Erk1/2 or SAPK/JNK. Phosphorylation of p38 MAP kinase dramatically stimulates its ability to phosphorylate protein substrates such as ATF-2 and Elk-1. MKK3 and MKK6 are both activated by different forms of cellular stress and inflammatory cytokines. Activation of MKK3 and MKK6 occurs through phosphorylation at Ser189 and Thr222 on MKK3 and Ser207 and Thr211 on MKK6.Three alternatively spliced transcript variants of MKK3 encoding distinct isoforms have been reported. Isoform B utilizes a different start codon compared to isoform C resulting in the production of a N-terminal segment of isoform B which is shorter and distinct from isoform C. MKK3b is the predominant form of MKK3 and strongly activates p38 MAP kinase (6)
Product Details
Description Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 3 with N terminal Flag tag.
NCBI Ref Seq NM_008928.4
RefSeq ORF Size 1044 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.