Online Inquiry
MAP2K2 Knockout Cell Line
SPL-01959
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 86bp deletion |
| Target Information | |
|---|---|
| Target Name | MEK2 |
| Gene Abbr. | MAP2K2 |
| Gene ID | 5605 |
| Full Name | mitogen-activated protein kinase kinase 2 |
| Alias | CFC4, MAPKK2, MEK2, MKK2, PRKMK2 |
| Species | Human |
| Genomic Locus | chr19:4117489 |
| Transcript | NM_030662 |
| WT Expression Level | 146.71 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, mental retardation, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 86bp deletion in a coding exon of MAP2K2. |
| Description | 86bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTCGAAAGGATCTCAGAGCT |
| PCR Primer |
Forward: CTGGAGCTAATCAGAATGCAGAGA Reverse: CTCCCTAGGTAGCTAACCCCTAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.