MAP2K2 Knockout Cell Line - CD BioSciences

service-banner

MAP2K2 Knockout Cell Line

MAP2K2 Knockout Cell Line

SPL-01958

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name MEK2
Gene Abbr. MAP2K2
Gene ID 5605
Full Name mitogen-activated protein kinase kinase 2
Alias CFC4, MAPKK2, MEK2, MKK2, PRKMK2
Species Human
Genomic Locus chr19:4123835
Transcript NM_030662
WT Expression Level 146.71 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, mental retardation, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of MAP2K2.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence ATGGTGAGCGCCGGCAGCAC
PCR Primer Forward: CTGCCTCGTGCACTCCTC
Reverse: TATGGGCCCCGGCTAGAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.