Map2k1 cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Map2k1 cDNA ORF Clone, Mouse, N-HA tag

Map2k1 cDNA ORF Clone, Mouse, N-HA tag

SPD-10232

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 1 with N terminal HA tag.
Target Information
Species Mouse
Target Name MEK1
Gene Abbr. Map2k1
Gene ID 26395
Full Name mitogen-activated protein kinase kinase 1
Alias MAPKK1, MEKK1, Mek1, Prkm, Prkmk1
Introduction MEK1 and MEK2, also called MAPK or Erk kinases, are dual-specificity protein kinases that function in a mitogen activated protein kinase cascade controlling cell growth and differentiation. Activation of MEK1 and MEK2 occurs through phosphorylation of two serine residues at positions 217 and 221, located in the activation loop of subdomain VIII, by Raf-like molecules. MEK1/2 is activated by a wide variety of growth factors and cytokines and also by membrane depolarization and calcium influx. Constitutively active forms of MEK1/2 are sufficient for the transformation of NIH/3T3 cells or the differentiation of PC-12 cells. MEK activates p44 and p42 MAP kinase by phosphorylating both threonine and tyrosine residues at sites located within the activation loop of kinase subdomain VIII.
Product Details
Description Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 1 with N terminal HA tag.
NCBI Ref Seq NM_008927.3
RefSeq ORF Size 1182 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.