Online Inquiry
Map2k1 cDNA ORF Clone, Mouse, C-Myc tag
SPD-10226
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 1 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | MEK1 |
Gene Abbr. | Map2k1 |
Gene ID | 26395 |
Full Name | mitogen-activated protein kinase kinase 1 |
Alias | MAPKK1, MEKK1, Mek1, Prkm, Prkmk1 |
Introduction | MEK1 and MEK2, also called MAPK or Erk kinases, are dual-specificity protein kinases that function in a mitogen activated protein kinase cascade controlling cell growth and differentiation. Activation of MEK1 and MEK2 occurs through phosphorylation of two serine residues at positions 217 and 221, located in the activation loop of subdomain VIII, by Raf-like molecules. MEK1/2 is activated by a wide variety of growth factors and cytokines and also by membrane depolarization and calcium influx. Constitutively active forms of MEK1/2 are sufficient for the transformation of NIH/3T3 cells or the differentiation of PC-12 cells. MEK activates p44 and p42 MAP kinase by phosphorylating both threonine and tyrosine residues at sites located within the activation loop of kinase subdomain VIII. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 1 with C terminal Myc tag. |
NCBI Ref Seq | NM_008927.3 |
RefSeq ORF Size | 1182 bp |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.