Online Inquiry
Map1lc3b cDNA ORF Clone, Mouse, N-His tag
SPD-09635
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse microtubule-associated protein 1 light chain 3 beta with N terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | LC3 |
Gene Abbr. | Map1lc3b |
Gene ID | 67443 |
Full Name | microtubule-associated protein 1 light chain 3 beta |
Alias | 1010001C15Rik, Atg, Atg8, LC3, LC3b |
Introduction | Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Autophagy is generally activated by conditions of nutrient deprivation, but it has also been associated with a number of physiological processes including development, differentiation, neurodegenerative diseases, infection, and cancer. Autophagy marker Light Chain 3 (LC3) was originally identified as a subunit of microtubule-associated proteins 1A and 1B (termed MAP1LC3) (4) and subsequently found to contain similarity to the yeast protein Apg8/Aut7/Cvt5 critical for autophagy. Three human LC3 isoforms (LC3A, LC3B, and LC3C) undergo posttranslational modifications during autophagy. Cleavage of LC3 at the carboxy terminus immediately following synthesis yields the cytosolic LC3-I form. During autophagy, LC3-I is converted to LC3-II through lipidation by a ubiquitin-like system involving Atg7 and Atg3 that allows for LC3 to become associated with autophagic vesicles. The presence of LC3 in autophagosomes and the conversion of LC3 to the lower migrating form, LC3-II, have been used as indicators of autophagy. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse microtubule-associated protein 1 light chain 3 beta with N terminal His tag. |
NCBI Ref Seq | NM_026160.4 |
RefSeq ORF Size | 423 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Restriction Sites | KpnI + XbaI (6kb + 0.42kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.