MAP1LC3B cDNA ORF Clone, Canine, C-HA tag - CD BioSciences

service-banner

MAP1LC3B cDNA ORF Clone, Canine, C-HA tag

MAP1LC3B cDNA ORF Clone, Canine, C-HA tag

SPD-09653

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Canine microtubule-associated protein 1 light chain 3 beta with C terminal HA tag.
Target Information
Species Canine
Target Name LC3
Gene Abbr. MAP1LC3B
Gene ID 479619
Full Name microtubule associated protein 1 light chain 3 beta
Introduction Autophagy is a catabolic process for the autophagosomic-lysosomal degradation of bulk cytoplasmic contents. Autophagy is generally activated by conditions of nutrient deprivation, but it has also been associated with a number of physiological processes including development, differentiation, neurodegenerative diseases, infection, and cancer. Autophagy marker Light Chain 3 (LC3) was originally identified as a subunit of microtubule-associated proteins 1A and 1B (termed MAP1LC3) (4) and subsequently found to contain similarity to the yeast protein Apg8/Aut7/Cvt5 critical for autophagy. Three human LC3 isoforms (LC3A, LC3B, and LC3C) undergo posttranslational modifications during autophagy. Cleavage of LC3 at the carboxy terminus immediately following synthesis yields the cytosolic LC3-I form. During autophagy, LC3-I is converted to LC3-II through lipidation by a ubiquitin-like system involving Atg7 and Atg3 that allows for LC3 to become associated with autophagic vesicles. The presence of LC3 in autophagosomes and the conversion of LC3 to the lower migrating form, LC3-II, have been used as indicators of autophagy.
Product Details
Description Full length Clone DNA of Canine microtubule-associated protein 1 light chain 3 beta with C terminal HA tag.
NCBI Ref Seq XM_536756.4
RefSeq ORF Size 378 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.