MAP1A Knockout Cell Line - CD BioSciences

service-banner

MAP1A Knockout Cell Line

MAP1A Knockout Cell Line

SPL-01947

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name MAP1A
Gene Abbr. MAP1A
Gene ID 4130
Full Name microtubule associated protein 1A
Alias MAP1L, MTAP1A
Species Human
Genomic Locus chr15:43521741
Transcript NM_002373
WT Expression Level 5.86 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1A heavy chain and LC2 light chain. Expression of this gene is almost exclusively in the brain. Studies of the rat microtubule-associated protein 1A gene suggested a role in early events of spinal cord development. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of MAP1A.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence ATTGGGGCAGACAACCTGCC
PCR Primer Forward: CTGAGTTCTCCGAGTATGTCTCTG
Reverse: CAAGCTCAGGAGAGATAAGGTTCTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.