Online Inquiry
MAK Knockout Cell Line
SPL-01940
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 71bp insertion |
| Target Information | |
|---|---|
| Target Name | MAK |
| Gene Abbr. | MAK |
| Gene ID | 4117 |
| Full Name | male germ cell associated kinase |
| Alias | RP62 |
| Species | Human |
| Genomic Locus | chr6:10808901 |
| Transcript | NM_005906 |
| WT Expression Level | 0.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The product of this gene is a serine/threonine protein kinase related to kinases involved in cell cycle regulation. Studies of the mouse and rat homologs have localized the kinase to the chromosomes during meiosis in spermatogenesis, specifically to the synaptonemal complex that exists while homologous chromosomes are paired. Mutations in this gene have been associated with ciliary defects resulting in retinitis pigmentosa 62. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 71bp insertion in a coding exon of MAK. |
| Description | 71bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACCAGAAAACTTGCTTTGTA |
| PCR Primer |
Forward: CCTCCTTCAGGTTGTTGTGC Reverse: AGTAGGGGTTATGCAGCCCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.