MAK Knockout Cell Line - CD BioSciences

service-banner

MAK Knockout Cell Line

MAK Knockout Cell Line

SPL-01939

Size Price
1 Unit Online Inquiry
Description
22bp deletion
Target Information
Target Name MAK
Gene Abbr. MAK
Gene ID 4117
Full Name male germ cell associated kinase
Alias RP62
Species Human
Genomic Locus chr6:10796252
Transcript NM_005906
WT Expression Level 0.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The product of this gene is a serine/threonine protein kinase related to kinases involved in cell cycle regulation. Studies of the mouse and rat homologs have localized the kinase to the chromosomes during meiosis in spermatogenesis, specifically to the synaptonemal complex that exists while homologous chromosomes are paired. Mutations in this gene have been associated with ciliary defects resulting in retinitis pigmentosa 62. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of MAK.
Description 22bp deletion
Parental Cell Line C631
Guide RNA Sequence AGGCCCTTCGTCAAATCATC
PCR Primer Forward: GTTTCTCCTGACTCTGTTGCTTTG
Reverse: CATGTGGGCTAATGATAAATGCCTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.