MAD2L1 Knockout Cell Line - CD BioSciences

service-banner

MAD2L1 Knockout Cell Line

MAD2L1 Knockout Cell Line

SPL-01932

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name Mad-2
Gene Abbr. MAD2L1
Gene ID 4085
Full Name mitotic arrest deficient 2 like 1
Alias HSMAD2, MAD2
Species Human
Genomic Locus chr4:120066677
Transcript NM_002358
WT Expression Level 129.25 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction MAD2L1 is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. MAD2L1 is related to the MAD2L2 gene located on chromosome 1. A MAD2 pseudogene has been mapped to chromosome 14. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of MAD2L1.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence CGATTTCGGCGCTCCCGCGC
PCR Primer Forward: GGATCTGCACTTAAAGGAAGAAACG
Reverse: CGTCGTTACTTTTGAAACGCTTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.