Online Inquiry
M6PR Knockout Cell Line
SPL-01929
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | M6PR |
| Gene Abbr. | M6PR |
| Gene ID | 4074 |
| Full Name | mannose-6-phosphate receptor, cation dependent |
| Alias | CD-M6PR, CD-MPR, MPR 46, MPR-46, MPR46 |
| Species | Human |
| Genomic Locus | chr12:8945519 |
| Transcript | NM_002355 |
| WT Expression Level | 342.16 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the P-type lectin family. P-type lectins play a critical role in lysosome function through the specific transport of mannose-6-phosphate-containing acid hydrolases from the Golgi complex to lysosomes. The encoded protein functions as a homodimer and requires divalent cations for ligand binding. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, May 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of M6PR. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTCAGGGTGTGCCGGGAAGC |
| PCR Primer |
Forward: GGTAGGAAGGGGAGTTTTCTTACTT Reverse: CAAATATTCACTCAGCCATGACCTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.