LYN cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

LYN cDNA ORF Clone, Human, C-HA tag

LYN cDNA ORF Clone, Human, C-HA tag

SPD-09955

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog , transcript variant 2 with C terminal HA tag.
Target Information
Species Human
Target Name LYN
Gene Abbr. LYN
Gene ID 4067
Full Name LYN proto-oncogene, Src family tyrosine kinase
Alias JTK8, p53Lyn, p56Lyn
Introduction Lyn, one of the Src family members, is predominantly expressed in hematopoietic cells. Two tyrosine residues have been reported to play a crucial role in the regulation of protein tyrosine kinases of the Src family. Autophosphorylation of Tyr396 (equivalent to Tyr416 of Src), located in the catalytic domain, correlates with enzyme activation. Csk-mediated phosphorylation of the carboxy-terminal Tyr507 (equivalent to Tyr527 of Src) inactivates the kinase. Tyrosine phosphorylation and activation of Lyn occurs upon association with cell surface receptors such as the B cell Ag receptor (BCR) and CD40. Studies using knockout mice have shown that the net effect of Lyn deficiency is to render B cells hypersensitive to BCR stimulation, suggesting that the most critical role for Lyn in vivo is in the down-regulation of B cell responses. Lyn is also involved in controlling the migration and development of specific B cell populations.
Product Details
Description Full length Clone DNA of Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog , transcript variant 2 with C terminal HA tag.
NCBI Ref Seq NM_001111097.1
RefSeq ORF Size 1476 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.