Ly96 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Ly96 cDNA ORF Clone, Mouse, untagged

Ly96 cDNA ORF Clone, Mouse, untagged

SPD-09850

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse lymphocyte antigen 96.
Target Information
Species Mouse
Target Name LY96
Gene Abbr. Ly96
Gene ID 17087
Full Name lymphocyte antigen 96
Alias ESO, ESOP-1, MD-2, MD2
Product Details
Description Full length Clone DNA of Mouse lymphocyte antigen 96.
NCBI Ref Seq NM_016923.2
RefSeq ORF Size 483 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.