Online Inquiry
LTK Knockout Cell Line
SPL-01916
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 23bp deletion |
| Target Information | |
|---|---|
| Target Name | LTK |
| Gene Abbr. | LTK |
| Gene ID | 4058 |
| Full Name | leukocyte receptor tyrosine kinase |
| Alias | TYK1 |
| Species | Human |
| Genomic Locus | chr15:41512998 |
| Transcript | NM_001135685 |
| WT Expression Level | 7.56 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the ros/insulin receptor family of tyrosine kinases. Tyrosine-specific phosphorylation of proteins is a key to the control of diverse pathways leading to cell growth and differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of LTK. |
| Description | 23bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGGCTCCAAGATACTAGGC |
| PCR Primer |
Forward: ATATCCTATTTCCACCCGCCTTAAC Reverse: TAGAAAACAGCCAAGACCCCTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.