LTB cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

LTB cDNA ORF Clone, Rhesus, untagged

LTB cDNA ORF Clone, Rhesus, untagged

SPD-09910

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus lymphotoxin beta (TNF superfamily, member 3).
Target Information
Species Rhesus
Target Name Lymphotoxin
Gene Abbr. LTB
Gene ID 715518
Full Name lymphotoxin beta
Product Details
Description Full length Clone DNA of Rhesus lymphotoxin beta (TNF superfamily, member 3).
NCBI Ref Seq NM_001047150.1
RefSeq ORF Size 735 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.