Online Inquiry
Lta cDNA ORF Clone, Mouse, untagged
SPD-09890
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse lymphotoxin A. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Lymphotoxin |
Gene Abbr. | Lta |
Gene ID | 16992 |
Full Name | lymphotoxin A |
Alias | L, LT, LT-, LT-[, LT-[a] |
Introduction | Lymphotoxin alpha, a member of the tumor necrosis factor family, is a cytokine produced by lymphocytes. LTA is highly inducible, secreted, and exists as homotrimeric molecule. LTA forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. LTA mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. LTA is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse lymphotoxin A. |
NCBI Ref Seq | NM_010735.2 |
RefSeq ORF Size | 609 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Restriction Sites | HindIII + XbaI (6.1kb + 0.61kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.