Lta cDNA ORF Clone, Mouse, N-HA tag - CD BioSciences

service-banner

Lta cDNA ORF Clone, Mouse, N-HA tag

Lta cDNA ORF Clone, Mouse, N-HA tag

SPD-09889

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse lymphotoxin A with N terminal HA tag.
Target Information
Species Mouse
Target Name Lymphotoxin
Gene Abbr. Lta
Gene ID 16992
Full Name lymphotoxin A
Alias L, LT, LT-, LT-[, LT-[a]
Introduction Lymphotoxin alpha, a member of the tumor necrosis factor family, is a cytokine produced by lymphocytes. LTA is highly inducible, secreted, and exists as homotrimeric molecule. LTA forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. LTA mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. LTA is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Mouse lymphotoxin A with N terminal HA tag.
NCBI Ref Seq NM_010735.2
RefSeq ORF Size 609 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites HindIII + XbaI (6kb + 0.6kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.