LTA cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

LTA cDNA ORF Clone, Human, untagged

LTA cDNA ORF Clone, Human, untagged

SPD-09900

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human lymphotoxin alpha (TNF superfamily, member 1).
Target Information
Species Human
Target Name Lymphotoxin
Gene Abbr. LTA
Gene ID 4049
Full Name lymphotoxin alpha
Alias LT, TNFB, TNFSF1, TNLG1E
Introduction Lymphotoxin alpha, a member of the tumor necrosis factor family, is a cytokine produced by lymphocytes. LTA is highly inducible, secreted, and exists as homotrimeric molecule. LTA forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. LTA mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. LTA is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human lymphotoxin alpha (TNF superfamily, member 1).
NCBI Ref Seq NM_000595.2
RefSeq ORF Size 603 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.6kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.