Online Inquiry
LTA cDNA ORF Clone, Canine, C-HA tag
SPD-09864
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Canine lymphotoxin alpha (TNF superfamily, member 1) with C terminal HA tag. |
Target Information | |
---|---|
Species | Canine |
Target Name | Lymphotoxin |
Gene Abbr. | LTA |
Gene ID | 607183 |
Full Name | lymphotoxin alpha |
Introduction | Lymphotoxin alpha, a member of the tumor necrosis factor family, is a cytokine produced by lymphocytes. LTA is highly inducible, secreted, and exists as homotrimeric molecule. LTA forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. LTA mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. LTA is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Canine lymphotoxin alpha (TNF superfamily, member 1) with C terminal HA tag. |
NCBI Ref Seq | XM_843793.2 |
RefSeq ORF Size | 615 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.