Online Inquiry
LRP8 Knockout Cell Line
SPL-01910
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | LRP8 |
| Gene Abbr. | LRP8 |
| Gene ID | 7804 |
| Full Name | LDL receptor related protein 8 |
| Alias | APOER2, HSZ75190, LRP-8, MCI1 |
| Species | Human |
| Genomic Locus | chr1:53289615 |
| Transcript | NM_017522 |
| WT Expression Level | 38.34 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the low density lipoprotein receptor (LDLR) family. Low density lipoprotein receptors are cell surface proteins that play roles in both signal transduction and receptor-mediated endocytosis of specific ligands for lysosomal degradation. The encoded protein plays a critical role in the migration of neurons during development by mediating Reelin signaling, and also functions as a receptor for the cholesterol transport protein apolipoprotein E. Expression of this gene may be a marker for major depressive disorder. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of LRP8. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CGTCACACTTCCACCGTTCG |
| PCR Primer |
Forward: CACAGAATGTTCAACTGGTTACCTC Reverse: GTGTTCAGATGCCTAAGGAATGAAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.