Online Inquiry
LRP6 Knockout Cell Line
SPL-01908
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
4bp deletion |
Target Information | |
---|---|
Target Name | LRP6 |
Gene Abbr. | LRP6 |
Gene ID | 4040 |
Full Name | LDL receptor related protein 6 |
Alias | ADCAD2, STHAG7 |
Species | Human |
Genomic Locus | chr12:12244413 |
Transcript | NM_002336 |
WT Expression Level | 16.40 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of LRP6. |
Description | 4bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATTATTGTCCCCCGATGGGC |
PCR Primer |
Forward: AAACCGAAAGGAGGTATGATGATCT Reverse: AGAGAATGCTACGATTGTAGTTGGA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.