LRP5 Knockout Cell Line - CD BioSciences

service-banner

LRP5 Knockout Cell Line

LRP5 Knockout Cell Line

SPL-01904

Size Price
1 Unit Online Inquiry
Description
23bp deletion
Target Information
Target Name LRP5
Gene Abbr. LRP5
Gene ID 4041
Full Name LDL receptor related protein 5
Alias BMND1, EVR1, EVR4, HBM, LR3
Species Human
Genomic Locus chr11:68347869
Transcript NM_002335
WT Expression Level 18.92 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of LRP5.
Description 23bp deletion
Parental Cell Line C631
Guide RNA Sequence CAACCGCCGGGACGTACGGC
PCR Primer Forward: CAACTTCCTGACAACGCCTTAG
Reverse: GGTTCAGGTAGGTCTGCTTGATG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.