Online Inquiry
LRP5 cDNA ORF Clone, Human, untagged
SPD-09819
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human low density lipoprotein receptor-related protein 6 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | LRP5 |
| Gene Abbr. | LRP5 |
| Gene ID | 4041 |
| Full Name | LDL receptor related protein 5 |
| Alias | BMND1, EVR1, EVR4, HBM, LR3, LRP-5, LRP-7 |
| Introduction | LRP5 and LRP6 are single-pass transmembrane proteins belonging to the low-density lipoprotein receptor (LDLR)-related protein family. Unlike other members of the LDLR family, LRP5 and LRP6 have four EGF and three LDLR repeats in the extracellular domain, and proline-rich motifs in the cytoplasmic domain. They function as co-receptors for Wnt and are required for the canonical Wnt/β-catenin signaling pathway. LRP5 and LRP6 are highly homologous and have redundant roles during development. The activity of LRP5 and LRP6 can be inhibited by the binding of some members of the Dickkopf (DKK) family of proteins. Upon stimulation with Wnt, LRP6 is phosphorylated at multiple sites including Thr1479, Ser1490, and Thr1493 by kinases such as GSK-3 and CK1. Phosphorylated LRP6 recruits axin to the membrane and presumably activates β-catenin signaling.LRP5 is involved in the regulation of bone homeostasis. Mutations and polymorphisms in LPR5 are associated with bone diseases like osteoporosis-pseudoglioma syndrome and high-bone-mass disorders. In addition, mutations in LRP5 are found in patients with hyperparathyroid tumor and breast cancer. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human low density lipoprotein receptor-related protein 6 |
| NCBI Ref Seq | NM_002336.2 |
| RefSeq ORF Size | 4842 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 4.84kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.