LRP5 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

LRP5 cDNA ORF Clone, Human, N-FLAG tag

LRP5 cDNA ORF Clone, Human, N-FLAG tag

SPD-09805

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human low density lipoprotein receptor-related protein 5 with N terminal Flag tag.
Target Information
Species Human
Target Name LRP5
Gene Abbr. LRP5
Gene ID 4041
Full Name LDL receptor related protein 5
Alias BMND1, EVR1, EVR4, HBM, LR3, LRP-5, LRP-7
Introduction LRP5 and LRP6 are single-pass transmembrane proteins belonging to the low-density lipoprotein receptor (LDLR)-related protein family. Unlike other members of the LDLR family, LRP5 and LRP6 have four EGF and three LDLR repeats in the extracellular domain, and proline-rich motifs in the cytoplasmic domain. They function as co-receptors for Wnt and are required for the canonical Wnt/β-catenin signaling pathway. LRP5 and LRP6 are highly homologous and have redundant roles during development. The activity of LRP5 and LRP6 can be inhibited by the binding of some members of the Dickkopf (DKK) family of proteins. Upon stimulation with Wnt, LRP6 is phosphorylated at multiple sites including Thr1479, Ser1490, and Thr1493 by kinases such as GSK-3 and CK1. Phosphorylated LRP6 recruits axin to the membrane and presumably activates β-catenin signaling.LRP5 is involved in the regulation of bone homeostasis. Mutations and polymorphisms in LPR5 are associated with bone diseases like osteoporosis-pseudoglioma syndrome and high-bone-mass disorders. In addition, mutations in LRP5 are found in patients with hyperparathyroid tumor and breast cancer.
Product Details
Description Full length Clone DNA of Human low density lipoprotein receptor-related protein 5 with N terminal Flag tag.
NCBI Ref Seq NM_002335.3
RefSeq ORF Size 4842 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1215G/A,1641T/C,2214C/T not causing the amino acid variation.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites HindIII + XbaI (6kb + 4.84kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.