Online Inquiry
LMTK2 Knockout Cell Line
SPL-01895
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 5bp deletion |
| Target Information | |
|---|---|
| Target Name | LMTK2 |
| Gene Abbr. | LMTK2 |
| Gene ID | 22853 |
| Full Name | lemur tyrosine kinase 2 |
| Alias | AATYK2, BREK, KPI-2, KPI2, LMR2 |
| Species | Human |
| Genomic Locus | chr7:98154761 |
| Transcript | NM_014916 |
| WT Expression Level | 6.95 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of LMTK2. |
| Description | 5bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTCTTGGGAGAGATTTACAC |
| PCR Primer |
Forward: CAAGCTTTTGGTGAGGTGGT Reverse: TGCAATTGCTCACAAAGCAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.