Lmna cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Lmna cDNA ORF Clone, Mouse, untagged

Lmna cDNA ORF Clone, Mouse, untagged

SPD-09517

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse lamin A.
Target Information
Species Mouse
Target Name Lamin A/C
Gene Abbr. Lmna
Gene ID 16905
Full Name lamin A
Alias Dhe
Introduction Lamins are nuclear membrane structural components that are important in maintaining normal cell functions such as cell cycle control, DNA replication, and chromatin organization. Lamin A/C is cleaved by caspase-6 and serves as a marker for caspase-6 activation. During apoptosis, lamin A/C is specifically cleaved into a large (41-50 kDa) and a small (28 kDa) fragment. The cleavage of lamins results in nuclear dysregulation and cell death.
Product Details
Description Full length Clone DNA of Mouse lamin A.
NCBI Ref Seq NM_001111102.2
RefSeq ORF Size 1725 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.