Online Inquiry
Lmna cDNA ORF Clone, Mouse, C-HA tag
SPD-09511
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse lamin A with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Lamin A/C |
Gene Abbr. | Lmna |
Gene ID | 16905 |
Full Name | lamin A |
Alias | Dhe |
Introduction | Lamins are nuclear membrane structural components that are important in maintaining normal cell functions such as cell cycle control, DNA replication, and chromatin organization. Lamin A/C is cleaved by caspase-6 and serves as a marker for caspase-6 activation. During apoptosis, lamin A/C is specifically cleaved into a large (41-50 kDa) and a small (28 kDa) fragment. The cleavage of lamins results in nuclear dysregulation and cell death. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse lamin A with C terminal HA tag. |
NCBI Ref Seq | NM_001111102.2 |
RefSeq ORF Size | 1725 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.