Limk2 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Limk2 cDNA ORF Clone, Mouse, C-FLAG tag

Limk2 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-09760

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse LIM motif-containing protein kinase 2 with C terminal Flag tag.
Target Information
Species Mouse
Target Name LIM kinase
Gene Abbr. Limk2
Gene ID 16886
Full Name LIM motif-containing protein kinase 2
Alias Lim, Limk, Limk-2, whe
Introduction LIM kinases (LIMK1 and LIMK2) are serine/threonine kinases that have two zinc finger motifs, known as LIM motifs, in their amino-terminal regulatory domains. LIM kinases are involved in actin cytoskeletal regulation downstream of Rho-family GTPases, PAKs, and ROCK. PAK1 and ROCK phosphorylate LIMK1 or LIMK2 at the conserved Thr508 or Thr505 residues in the activation loop, increasing LIMK activity. Activated LIM kinases inhibit the actin depolymerization activity of cofilin by phosphorylation at the amino-terminal Ser3 residue of cofilin.
Product Details
Description Full length Clone DNA of Mouse LIM motif-containing protein kinase 2 with C terminal Flag tag.
NCBI Ref Seq NM_010718.3
RefSeq ORF Size 1917 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.