LIMK2 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

LIMK2 cDNA ORF Clone, Human, untagged

LIMK2 cDNA ORF Clone, Human, untagged

SPD-09779

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human LIM domain kinase 2.
Target Information
Species Human
Target Name LIM kinase
Gene Abbr. LIMK2
Gene ID 3985
Full Name LIM domain kinase 2
Introduction LIM kinases (LIMK1 and LIMK2) are serine/threonine kinases that have two zinc finger motifs, known as LIM motifs, in their amino-terminal regulatory domains. LIM kinases are involved in actin cytoskeletal regulation downstream of Rho-family GTPases, PAKs, and ROCK. PAK1 and ROCK phosphorylate LIMK1 or LIMK2 at the conserved Thr508 or Thr505 residues in the activation loop, increasing LIMK activity. Activated LIM kinases inhibit the actin depolymerization activity of cofilin by phosphorylation at the amino-terminal Ser3 residue of cofilin.
Product Details
Description Full length Clone DNA of Human LIM domain kinase 2.
NCBI Ref Seq NM_005569.3
RefSeq ORF Size 1917 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutation 1209C/G not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.92kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.