Online Inquiry
LIMK2 cDNA ORF Clone, Human, C-FLAG tag
SPD-09770
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human LIM domain kinase 2 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | LIM kinase |
Gene Abbr. | LIMK2 |
Gene ID | 3985 |
Full Name | LIM domain kinase 2 |
Introduction | LIM kinases (LIMK1 and LIMK2) are serine/threonine kinases that have two zinc finger motifs, known as LIM motifs, in their amino-terminal regulatory domains. LIM kinases are involved in actin cytoskeletal regulation downstream of Rho-family GTPases, PAKs, and ROCK. PAK1 and ROCK phosphorylate LIMK1 or LIMK2 at the conserved Thr508 or Thr505 residues in the activation loop, increasing LIMK activity. Activated LIM kinases inhibit the actin depolymerization activity of cofilin by phosphorylation at the amino-terminal Ser3 residue of cofilin. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human LIM domain kinase 2 with C terminal Flag tag. |
NCBI Ref Seq | NM_005569.3 |
RefSeq ORF Size | 1917 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.