LFNG cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

LFNG cDNA ORF Clone, Human, untagged

LFNG cDNA ORF Clone, Human, untagged

SPD-09830

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminylt
Target Information
Species Human
Target Name Lunatic Fringe
Gene Abbr. LFNG
Gene ID 3955
Full Name LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Alias SCDO3
Introduction Lunatic Fringe (Beta-1,3-N-acetylglucosaminyltransferase, LFNG) is a single-pass type II Golgi membrane glycosyltransferase that catalyzes the elongation of O-linked fucose residues on EGF-like repeats of Notch signaling molecules. Fucosylation of EGF-like repeats serves to fine-tune Notch ligand-receptor interactions, thereby modulating downstream Notch pathway activity. Studies in genetic mouse models have shown that Lunatic Fringe-mediated Notch regulation is critical for somite patterning during vertebrate embryogenesis. Consistent with this, loss-of-function mutations in human LFNG are associated with spondylocostal dysostoses, a heritable skeletal growth disorder characterized by malformations of the spinal column and thoracic structures. Lunatic Fringe continues to modulate Notch signaling postnatally and is implicated as a putative tumor suppressor in multiple Notch-related cancers.
Product Details
Description Full length Clone DNA of Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminylt
RefSeq ORF Size 1140 bp
Sequence Information The translated amino acid sequence is identical with NP_001035257.1.
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.14kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.