Online Inquiry
LFNG cDNA ORF Clone, Human, N-FLAG tag
SPD-09825
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminylt with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Lunatic Fringe |
| Gene Abbr. | LFNG |
| Gene ID | 3955 |
| Full Name | LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase |
| Alias | SCDO3 |
| Introduction | Lunatic Fringe (Beta-1,3-N-acetylglucosaminyltransferase, LFNG) is a single-pass type II Golgi membrane glycosyltransferase that catalyzes the elongation of O-linked fucose residues on EGF-like repeats of Notch signaling molecules. Fucosylation of EGF-like repeats serves to fine-tune Notch ligand-receptor interactions, thereby modulating downstream Notch pathway activity. Studies in genetic mouse models have shown that Lunatic Fringe-mediated Notch regulation is critical for somite patterning during vertebrate embryogenesis. Consistent with this, loss-of-function mutations in human LFNG are associated with spondylocostal dysostoses, a heritable skeletal growth disorder characterized by malformations of the spinal column and thoracic structures. Lunatic Fringe continues to modulate Notch signaling postnatally and is implicated as a putative tumor suppressor in multiple Notch-related cancers. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminylt with N terminal Flag tag. |
| NCBI Ref Seq | BC014851 |
| RefSeq ORF Size | 753 bp |
| Vector | pCMV3-SP-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.