Lep cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Lep cDNA ORF Clone, Mouse, N-His tag

Lep cDNA ORF Clone, Mouse, N-His tag

SPD-09706

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse leptin with N terminal His tag.
Target Information
Species Mouse
Target Name Leptin
Gene Abbr. Lep
Gene ID 16846
Full Name leptin
Alias ob, obese
Introduction Leptin, the obese (ob) gene product, is a small protein expressed in and secreted from adipose tissue of normal rodents. Studies suggest leptin acts as a circulating hormone capable of regulating body-weight homeostasis and energy balance. One possible target tissue for leptin is the hypothalamus, a proposed control center for satiety and energy expenditure. Ob gene knockout mice are characterized by several metabolic abnormalities including hyperglucocorticoidemia, hyperinsulinemia and insulin resistance, hyperglycemia, altered central nervous system activity, reduced metabolic rate of brown adipose tissue, and a large increase in white adipose tissue. Studies show that the administration of recombinant leptin to ob knockout mice reduces food intake and increases energy expenditure.
Product Details
Description Full length Clone DNA of Mouse leptin with N terminal His tag.
NCBI Ref Seq NM_008493.3
RefSeq ORF Size 534 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 0.53kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.