LEF1 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

LEF1 cDNA ORF Clone, Human, N-HA tag

LEF1 cDNA ORF Clone, Human, N-HA tag

SPD-09698

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human lymphoid enhancer-binding factor 1 with N terminal HA tag.
Target Information
Species Human
Target Name LEF1
Gene Abbr. LEF1
Gene ID 51176
Full Name lymphoid enhancer binding factor 1
Alias LEF-1, TCF10, TCF1ALPHA, TCF7L3
Introduction LEF1 and TCF are members of the high mobility group (HMG) DNA binding protein family of transcription factors that consists of the following: Lymphoid Enhancer Factor 1 (LEF1), T Cell Factor 1 (TCF1/TCF7), TCF3/TCF7L1, and TCF4/TCF7L2. LEF1 and TCF1/TCF7 were originally identified as important factors that regulate early lymphoid development and act downstream in Wnt signaling. LEF1 and TCF bind to Wnt response elements to provide docking sites for β-catenin, which translocates to the nucleus to promote the transcription of target genes upon activation of Wnt signaling. LEF1 and TCF are dynamically expressed during development and aberrant activation of the Wnt signaling pathway is involved in many types of cancers, including colon cancer.LEF1 has several isoforms due to alternative splicing. LEF1 also has an alternative promoter that is preferentially active in lymphocytes. The isoforms generated by this alternative promoter have no amino-terminal β-catenin binding domain and may function in a dominant negative manner.
Product Details
Description Full length Clone DNA of Human lymphoid enhancer-binding factor 1 with N terminal HA tag.
NCBI Ref Seq NM_016269.4
RefSeq ORF Size 1242 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 630T/C not causing the amino acid variation.
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.24kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.