Online Inquiry
Lck cDNA ORF Clone, Mouse, C-FLAG tag
SPD-09670
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse lymphocyte protein tyrosine kinase |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Lck |
| Gene Abbr. | Lck |
| Gene ID | 16818 |
| Full Name | lymphocyte protein tyrosine kinase |
| Alias | Hck-3, Lsk, Lskt, p56 |
| Introduction | The Src family of protein tyrosine kinases, which includes Src, Lyn, Fyn, Yes, Lck, Blk, and Hck, are important in the regulation of growth and differentiation of eukaryotic cells. Src activity is regulated by tyrosine phosphorylation at two sites, but with opposing effects. While phosphorylation at Tyr416 in the activation loop of the kinase domain upregulates enzyme activity, phosphorylation at Tyr527 in the carboxy-terminal tail by Csk renders the enzyme less active.Lck is essential for T-lymphocyte activation and differentiation. Phosphorylation of Tyr505 in the carboxy-terminal tail of Lck downregulates its catalytic activity, while phosphorylation of Tyr394 leads to an increase in Lck activity. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse lymphocyte protein tyrosine kinase |
| NCBI Ref Seq | NM_010693.3 |
| RefSeq ORF Size | 1530 bp |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.