LCK cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

LCK cDNA ORF Clone, Human, N-HA tag

LCK cDNA ORF Clone, Human, N-HA tag

SPD-09688

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human lymphocyte-specific proteintyrosine kinase (LCK), transcript variant 1 with N terminal HA tag.
Target Information
Species Human
Target Name Lck
Gene Abbr. LCK
Gene ID 3932
Full Name LCK proto-oncogene, Src family tyrosine kinase
Alias IMD22, LSK, YT16, p56lck, pp58lck
Introduction The Src family of protein tyrosine kinases, which includes Src, Lyn, Fyn, Yes, Lck, Blk, and Hck, are important in the regulation of growth and differentiation of eukaryotic cells. Src activity is regulated by tyrosine phosphorylation at two sites, but with opposing effects. While phosphorylation at Tyr416 in the activation loop of the kinase domain upregulates enzyme activity, phosphorylation at Tyr527 in the carboxy-terminal tail by Csk renders the enzyme less active.Lck is essential for T-lymphocyte activation and differentiation. Phosphorylation of Tyr505 in the carboxy-terminal tail of Lck downregulates its catalytic activity, while phosphorylation of Tyr394 leads to an increase in Lck activity.
Product Details
Description Full length Clone DNA of Human lymphocyte-specific proteintyrosine kinase (LCK), transcript variant 1 with N terminal HA tag.
NCBI Ref Seq NM_001042771.1
RefSeq ORF Size 1530 bp
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.