Online Inquiry
LATS2 Knockout Cell Line
SPL-01873
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 17bp insertion |
| Target Information | |
|---|---|
| Target Name | LATS2 |
| Gene Abbr. | LATS2 |
| Gene ID | 26524 |
| Full Name | large tumor suppressor kinase 2 |
| Alias | KPM |
| Species | Human |
| Genomic Locus | chr13:21045911 |
| Transcript | NM_014572 |
| WT Expression Level | 4.74 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 17bp insertion in a coding exon of LATS2. |
| Description | 17bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCGGTTCAGGGGCTACCCGC |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGCTTCAAGTAGTTGCCAAACCATTCT Reverse: GTTGCGTGAAAATGACAAATGAACA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.