LAT Knockout Cell Line - CD BioSciences

service-banner

LAT Knockout Cell Line

LAT Knockout Cell Line

SPL-01872

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name LAT
Gene Abbr. LAT
Gene ID 27040
Full Name linker for activation of T cells
Alias IMD52, LAT1, pp36
Species Human
Genomic Locus chr16:28985719
Transcript NM_001014987
WT Expression Level 6.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is phosphorylated by ZAP-70/Syk protein tyrosine kinases following activation of the T-cell antigen receptor (TCR) signal transduction pathway. This transmembrane protein localizes to lipid rafts and acts as a docking site for SH2 domain-containing proteins. Upon phosphorylation, this protein recruits multiple adaptor proteins and downstream signaling molecules into multimolecular signaling complexes located near the site of TCR engagement. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of LAT.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence ATCTGAGGATGTGCTGTCGT
PCR Primer Forward: ATCTTCATCTGGCCTTGACTCTG
Reverse: TGGATACAAACTGGTAAAGGAGACA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.