Online Inquiry
LAT Knockout Cell Line
SPL-01870
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
10bp deletion |
Target Information | |
---|---|
Target Name | LAT |
Gene Abbr. | LAT |
Gene ID | 27040 |
Full Name | linker for activation of T cells |
Alias | IMD52, LAT1, pp36 |
Species | Human |
Genomic Locus | chr16:28985864 |
Transcript | NM_001014987 |
WT Expression Level | 6.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is phosphorylated by ZAP-70/Syk protein tyrosine kinases following activation of the T-cell antigen receptor (TCR) signal transduction pathway. This transmembrane protein localizes to lipid rafts and acts as a docking site for SH2 domain-containing proteins. Upon phosphorylation, this protein recruits multiple adaptor proteins and downstream signaling molecules into multimolecular signaling complexes located near the site of TCR engagement. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of LAT. |
Description | 10bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CGTTTGAACTGGATGCCCCT |
PCR Primer |
Forward: CTACGACAGCACATCCTCAGATAG Reverse: TCAAGGCCTCAAAGAACAGACTAAG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.