Online Inquiry
LAMTOR3 cDNA ORF Clone, Human, untagged
SPD-09568
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 3. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | LAMTOR3 |
| Gene Abbr. | LAMTOR3 |
| Gene ID | 8649 |
| Full Name | late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 |
| Alias | MAP2K1IP1, MAPBP, MAPKSP1, MP1, PRO0633 |
| Introduction | mTORC1 kinase complex is a critical component in the regulation of cell growth. Its activity is modulated by energy levels, growth factors, and amino acids. The four related GTPases, RagA, RagB, RagC, and RagD, have been shown to interact with raptor in mTORC1. These interactions are both necessary and sufficient for mTORC1 activation in response to amino acid signals. A protein complex consisting of LAMTOR1/C11orf59, LAMTOR2/ROBLD3, and LAMTOR3/MAPKSP1 has been identified to interact with and recruit the four Rag GTPases to the surface of lysosomes. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human late endosomal/lysosomal adaptor, MAPK and MTOR activator 3. |
| NCBI Ref Seq | NM_021970.3 |
| RefSeq ORF Size | 375 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.