Lamtor1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Lamtor1 cDNA ORF Clone, Mouse, untagged

Lamtor1 cDNA ORF Clone, Mouse, untagged

SPD-09537

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse late endosomal/lysosomal adaptor, MAPK and MTOR activator 1.
Target Information
Species Mouse
Target Name LAMTOR1
Gene Abbr. Lamtor1
Gene ID 66508
Full Name late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Alias 2400001E08Rik, Pdro, p1, p18
Product Details
Description Full length Clone DNA of Mouse late endosomal/lysosomal adaptor, MAPK and MTOR activator 1.
NCBI Ref Seq NM_025605.3
RefSeq ORF Size 486 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.