KSR2 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

KSR2 cDNA ORF Clone, Human, untagged

KSR2 cDNA ORF Clone, Human, untagged

SPD-09507

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human kinase suppressor of ras 2.
Target Information
Species Human
Target Name KSR2
Gene Abbr. KSR2
Gene ID 283455
Full Name kinase suppressor of ras 2
Product Details
Description Full length Clone DNA of Human kinase suppressor of ras 2.
NCBI Ref Seq BC127603
RefSeq ORF Size 2490 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.