Online Inquiry
Kras cDNA ORF Clone, Mouse, N-His tag
SPD-13064
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Ras |
| Gene Abbr. | Kras |
| Gene ID | 16653 |
| Full Name | Kirsten rat sarcoma viral oncogene homolog |
| Alias | AI929937, K-, K-Ras, K-Ras 2, K-ras |
| Introduction | The 21 kDa guanine-nucleotide binding proteins (K-Ras, H-Ras, and N-Ras) cycle between active (GTP-bound) and inactive (GDP-bound) forms. Receptor tyrosine kinases and G protein-coupled receptors activate Ras, which then stimulates the Raf-MEK-MAPK pathway. GTPase-activating proteins (GAP) normally facilitate the inactivation of Ras. However, research studies have shown that in 30% of human tumors, point mutations in Ras prevent the GAP-mediated inhibition of this pathway. The most common oncogenic Ras mutation found in tumors is Gly12 to Asp12 (G12D), which prevents Ras inactivation, possibly by increasing the overall rigidity of the protein. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog with N terminal His tag. |
| NCBI Ref Seq | NM_021284.6 |
| RefSeq ORF Size | 567 bp |
| Vector | pCMV3-SP-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.