Kras cDNA ORF Clone, Mouse, C-Myc tag - CD BioSciences

service-banner

Kras cDNA ORF Clone, Mouse, C-Myc tag

Kras cDNA ORF Clone, Mouse, C-Myc tag

SPD-13061

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog with C terminal Myc tag.
Target Information
Species Mouse
Target Name Ras
Gene Abbr. Kras
Gene ID 16653
Full Name Kirsten rat sarcoma viral oncogene homolog
Alias AI929937, K-, K-Ras, K-Ras 2, K-ras
Introduction The 21 kDa guanine-nucleotide binding proteins (K-Ras, H-Ras, and N-Ras) cycle between active (GTP-bound) and inactive (GDP-bound) forms. Receptor tyrosine kinases and G protein-coupled receptors activate Ras, which then stimulates the Raf-MEK-MAPK pathway. GTPase-activating proteins (GAP) normally facilitate the inactivation of Ras. However, research studies have shown that in 30% of human tumors, point mutations in Ras prevent the GAP-mediated inhibition of this pathway. The most common oncogenic Ras mutation found in tumors is Gly12 to Asp12 (G12D), which prevents Ras inactivation, possibly by increasing the overall rigidity of the protein.
Product Details
Description Full length Clone DNA of Mouse v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog with C terminal Myc tag.
NCBI Ref Seq NM_021284.6
RefSeq ORF Size 567 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.