Online Inquiry
KMT2A Knockout Cell Line
SPL-01846
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 19bp deletion |
| Target Information | |
|---|---|
| Target Name | KMT2A |
| Gene Abbr. | KMT2A |
| Gene ID | 4297 |
| Full Name | lysine methyltransferase 2A |
| Alias | ALL-1, CXXC7, HRX, HTRX1, MLL |
| Species | Human |
| Genomic Locus | chr11:118472433 |
| Transcript | NM_005933 |
| WT Expression Level | 9.62 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of KMT2A. |
| Description | 19bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATCCTCTATAAACCGCCGAG |
| PCR Primer |
Forward: GAGTCTGAAGACATTTGAGAGGAGT Reverse: AGGGGGCTCAAAAGAAAATTGAAAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.